Review



sara cherry n a sendai virus sev charles river labs cantell strain  (Charles River Laboratories)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Charles River Laboratories sara cherry n a sendai virus sev charles river labs cantell strain
    Sara Cherry N A Sendai Virus Sev Charles River Labs Cantell Strain, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus/10__1016_slash_j__celrep__2025__116166-218-124-130
    Average 86 stars, based on 1 article reviews
    sara cherry n a sendai virus sev charles river labs cantell strain - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Infection:

    Article Title: Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-κB p50 and G9a-GLP and Represses Cytokine Transcription.
    Article Snippet: .. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBRGreenMasterMix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC),M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG,AGCCATGGTAAGGACACCTC). ..

    Virus:

    Article Title: Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-κB p50 and G9a-GLP and Represses Cytokine Transcription.
    Article Snippet: .. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBRGreenMasterMix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC),M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG,AGCCATGGTAAGGACACCTC). ..

    Article Title: Human Cytomegalovirus IE86 Attenuates Virus- and Tumor Necrosis Factor Alpha-Induced NFκB-Dependent Gene Expression
    Article Snippet: .. Sendai virus (Charles River laboratories) infections were performed as described previously (54). .. Cells were treated with TNF- (50 ng/ml) (sc-4564; Santa Cruz) in serum-free Dulbecco’s modified Eagle’s medium.

    Isolation:

    Article Title: Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-κB p50 and G9a-GLP and Represses Cytokine Transcription.
    Article Snippet: .. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBRGreenMasterMix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC),M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG,AGCCATGGTAAGGACACCTC). ..

    Reverse Transcription:

    Article Title: Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-κB p50 and G9a-GLP and Represses Cytokine Transcription.
    Article Snippet: .. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBRGreenMasterMix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC),M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG,AGCCATGGTAAGGACACCTC). ..

    cDNA Synthesis:

    Article Title: Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-κB p50 and G9a-GLP and Represses Cytokine Transcription.
    Article Snippet: .. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBRGreenMasterMix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC),M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG,AGCCATGGTAAGGACACCTC). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-κB p50 and G9a-GLP and Represses Cytokine Transcription.
    Article Snippet: .. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBRGreenMasterMix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC),M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG,AGCCATGGTAAGGACACCTC). ..



    Similar Products

    95
    ATCC 907 sendai virus cantell strain charles river laboratories cat
    907 Sendai Virus Cantell Strain Charles River Laboratories Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/Sendai+virus/pm37028415-215-39-54
    Average 95 stars, based on 1 article reviews
    907 sendai virus cantell strain charles river laboratories cat - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    86
    Charles River Laboratories sara cherry n a sendai virus sev charles river labs cantell strain
    Sara Cherry N A Sendai Virus Sev Charles River Labs Cantell Strain, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus/10__1016_slash_j__celrep__2025__116166-218-124-130
    Average 86 stars, based on 1 article reviews
    sara cherry n a sendai virus sev charles river labs cantell strain - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Charles River Laboratories sendai virus charles river
    Sendai Virus Charles River, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus+cantell+strain/pm34400522-83-8-10
    Average 90 stars, based on 1 article reviews
    sendai virus charles river - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Charles River Laboratories virus strains sendai virus strain cantell charles river laboratory loo
    Virus Strains Sendai Virus Strain Cantell Charles River Laboratory Loo, supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus/pmc07797372__mmc1-41-46-52
    Average 86 stars, based on 1 article reviews
    virus strains sendai virus strain cantell charles river laboratory loo - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    95
    ATCC sendai virus charles river product code vr 907 encephalomyocarditis virus murine
    Sendai Virus Charles River Product Code Vr 907 Encephalomyocarditis Virus Murine, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/Sendai+virus/pmc06525047-1235-241-251
    Average 95 stars, based on 1 article reviews
    sendai virus charles river product code vr 907 encephalomyocarditis virus murine - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    90
    Charles River Laboratories sendai virus (charles river)
    Sendai Virus (Charles River), supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus+cantell+strain/pmc03051279-59-25-27
    Average 90 stars, based on 1 article reviews
    sendai virus (charles river) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Charles River Laboratories sendai virus (sev) (strain cantell; charles river laboratories)
    Sendai Virus (Sev) (Strain Cantell; Charles River Laboratories), supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus++sev++cantell+strain/10__1128_slash_jvi__01125___09-67-29-34
    Average 90 stars, based on 1 article reviews
    sendai virus (sev) (strain cantell; charles river laboratories) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Charles River Laboratories sendai virus, cantell strain (charles river)
    Sendai Virus, Cantell Strain (Charles River), supplied by Charles River Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sendai+virus+charles+river/sendai+virus+cantell+strain/pmc02774772__NIHMS137913___supplement___1-113-2-4
    Average 90 stars, based on 1 article reviews
    sendai virus, cantell strain (charles river) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results